Single-strained DNA (ssDNA)-templated silver nanoclusters (DNA-AgNCs) have received increasing attention due to their good biocompatibility and low toxicity ^{[1, 2, 3]}. Especially, C-rich oligonucleotides have been found to be capable of serving as ideal templates to form highly fluorescent DNA-AgNCs due to the specific nature of the C-Ag⁺ interaction ^{[4, 5, 6]}. Nucleic acids are also reported to interact with metal ions through nucleobases and the phosphodiester backbone ^[7]. The fluorescent properties of DNA-AgNCs can be modulated by the change of the conformation and the size. For example, silver nanoclusters constructed by the bifunctional oligonucleotide were used as fluorescence sensors to sense HepG-2 cells because the complementary sequence can assemble with DNA-AgNCs with the change of conformation and the size ^[8]. Recently, we found that the near-infrared fluorescent DNA-AgNCs constructed by the bifunctional oligonucleotide with parallel homoduplex conformation could recognize one isomer of boradiazaindacenes (BODIPY) based on the different energy transfer in the DNA-AgNCs-compounds conjugated system ^[9]. Cytosine bases can bind silver ions, which makes C-rich oligonucleotides a good template to synthesize fluorescent silver nanoclusters ^[10]. The sequence of CGGGCCAAGAGTGTGCTAAA (DNA_T) has been used as forward nucleotides in the measurement of Glucose transporter 1 (GLUT1) by the Polymerase Chain Reaction (PCR) method ^[11]. The combination of C3T-rich aptamer and CGGGCCAAGAGTGTGCTAAA can form a new bifunctional oligonucleotide, which can be used as a template in the synthesis of high luminescence DNA-AgNCs. Herein, we report new types of assembled DNA-AgNCs and their responses to Fe(Ⅲ/Ⅱ) ions.

All chemicals used were obtained from commercial sources and directly used without additional purification. Cytosine-(C)-rich DNA scaffolds were purchased from Sangon Inc. (Shanghai, China), the sequences of different DNA are shown in Table 1. Silver nitrates (AgNO₃), citric acid, NaBH₄ and Fe(NO₃)₃ were all obtained from Sinopharm Chemical Reagent Co., Ltd. (Shanghai, China). Transmission electron microscopy (TEM) was performed at room temperature on a JEOL JEM-200CX transmission electron microscope using an accelerating voltage of 200 kV. The electronic absorption spectrum was recorded using a UV-2450 UV-vis spectrophotometer at room temperature. Fluorescence measurements were performed on a fluorescence spectrofluorometer Model CARY Eclipse (VARIAN, USA), a 1.0 cm quartz cell, slit width = 5 nm. The mixtures were subjected to fluorescence measurement. The fluorescence quenching constants were calculated according to the formula: Q = (F₀ × F)/F₀ (F₀ is the original fluorescence intensity; F is the fluorescence intensity of the mixture).

Table 1

Table 1 Oligonucleotides designed for use in this study.

Table 1 Oligonucleotides designed for use in this study.

DNA-silver nanoclusters (DNA-AgNCs) were synthesized by combining DNA template and Ag⁺ solutions in a 10 mmol/L citrate buffer at pH = 5. The final concentration of AgNO₃ and DNA is 6.4 μmol/L and 200 μmol/L, respectively. Then the mixture was heated to 72 ℃ and maintained for 3 min, followed by slowly cooling to room temperature. The whole cooling process is about 3 h. An aqueous solution of NaBH₄ was added to give a final concentration of 2 BH₄ -/Ag⁺ (molar ratio) at room temperature, and the resulting solution was vigorously shaken for 1 min and left staying for 3 days in the dark at 4 ℃ ^[8].

DNA-based silver nanoclusters (DNA₁-AgNCs) were synthesized by using a template containing a C3T-rich scaffold (DNA_C) and an enhance sequence (DNA_T) (Table 1). It can be seen that the DNA₁-AgNCs have the sizes of ca. 2-4 nm with an emission maximum at 663 nm (Fig. 1A and B). The UV-vis absorption peaks of the DNA₁-AgNCs are at 410 nm and 600 nm (Fig. 1B). In order to investigate the key section of the DNA_T on the emission of synthesized silver nanoclusters, DNA₁ was divided into DNA₂ (DNA₂ = DNA_C + CGGGTGT (GT are linking sites because GT can recognize CA in DNA₃)) and DNA₃ (CACTGT to replace CGGG in DNA_T) (Table 1), and another kind of DNA-based silver nanoclusters (DNA₂-AgNCs) was obtained. The sizes of DNA₂- AgNCs are in the range of 8-10 nm (Fig. S1A in Supporting information). The DNA₁-AgNCs and DNA₂-AgNCs have the same emission maximum at 663 nm due to the same DNA_C used as the template to stabilize the Ag clusters. The quantum yield (Φ) of DNA₁-AgNCs and DNA₂-AgNCs for the emission at 660 nm is 0.33 and 0.25, respectively, using Ru(bpy)₃Cl₂ as reference (Φ = 0.062), which indicates that DNA₃ may be an enhancer nucleotide. This will provide an opportunity to synthesize functional DNA-based sliver nanoclusters with red emission by the assembly of DNA₂-AgNCs with a multifunctional enhancer.

Fig. 1

	Download: JPG larger image
Fig. 1.(A) A TEM image of DNA1-AgNCs. (B) UV-vis absorption spectrum and fluorescence spectra of DNA1-AgNCs: (a) the UV-vis absorption spectrum; (b) and (c) the excitation and emission fluorescent spectra, respectively (λex = 600 nm, λem = 663 nm).

It is interesting to find that once adding DNA₃ (a modified DNA_T) to the solution of DNA₂-AgNCs, an enhanced emission at 663 nm was observed, and when the ratio of DNA₃ and DNA₂- AgNCs came to 1:1, the fluorescence was nearly stable (Fig. 2A), indicating that formation of luminescence DNA₃-DNA₂-AgNCs. To explore the key bases in DNA₃, DNA₄(no GAG containing sequence) and DNA₅ (double GAG containing sequence) were designed (Table 1) and used as replacer of DNA₃. Fluorescence enhancement was observed after the addition of DNA₅ while DNA₄ had negligible impact on the fluorescence of DNA₂-AgNCs. Hence, this further confirms GAG is an emission enhancer of DNA₂-AgNCs (Fig. S2 in Supporting information). Moreover, the fluorescent DNA_3C-AgNCs, DNA_4C-AgNCs and DNA_5C-AgNCs were synthesized by using assemblies of DNA_C and DNA₃ (1:1) or DNA_C and DNA₄ (1:1) or DNA_C and DNA₅ (1:1), respectively, as templates. The emission wavelength of DNA_3C-AgNCs, DNA_4CAgNCs and DNA_5C-AgNCs are 686 nm, 633 nm and 697 nm, respectively (Fig. S3). This indicates GAGGAG can also assemble with C3T-rich oligonucleotides for the construction of red emission DNA_n-AgNCs.

Fig. 2

Download: JPG larger image

Fig. 2. (A) Emission spectra of the fluorescent DNA2-AgNCs (λex = 600 nm, λem = 663 nm, 2 μmol/L) in the presence of DNA3 (the concentration of DNA3 from the bottom: 0, 0.1, 0. 5, 1.0, 1.5, 2.0, 2.5 μmol/L); (B) the fluorescence quenching constants of the DNA-AgNCs (2 μmol/L) incubated with a concentration of 0.2 μmol/L Fe3+ and Fe2+ (I: DNA1-AgNCs, Ⅱ: DNA2-AgNCs, Ⅲ: DNA4C-AgNCs, IV: DNA5C-AgNCs).

Results demonstrated DNA₁-AgNCs are more sensitive to Fe³⁺ and Fe²⁺ ions than DNA₂-AgNCs (Fig. 2B). This implies DNA₃ may have some specific relationship with Fe(Ⅲ/Ⅱ) ions. Compared with DNA_4C-AgNCs, DNA_5C-AgNCs are more sensitive to Fe³⁺ or Fe²⁺ (Fig. 2B), which suggests that the GAG containing sequences may mediate the DNA-iron interplay. Because the DNA₃ is an emission enhancer of DNA₂-AgNCs, the effect of Fe³⁺ on the emission of DNA₃-DNA₂-AgNCs assemblies was studied. The fluorescence emission decreased when Fe³⁺ was added into the mixture of DNA₃ and DNA₂-AgNCs (Fig. S4 in Supporting information). In contrast, the 1:1 (molar ratio) mixture of DNA₃ and Fe³⁺ showed no obvious influence on the fluorescence of DNA₂-AgNCs (Fig. S4 in Supporting information). We deduce that the free Fe³⁺ ions can bind to the DNA₃ section in the DNA₃-DNA₂-AgNCs system, leading to the deceased emission because guanine contains an imidazole ring which allows metal ions to coordinate ^[12]. This further confirms that GAG is the key factor to the interaction of free Fe³⁺ with DNA₃-DNA₂-AgNCs or DNA₁-AgNCs. To confirm the combination of GAG and Fe³⁺, DNA₆ was designed (Table 1). The main mass spectral peaks at m/z = 1=3.5 [(DNA₆)₅Fe₂]⁶⁺ and 1240.3 [(DNA₆)₂Fe]³⁺ indicate that the main ratios of DNA₆ and Fe³⁺ are about 5:2 and 2:1 (Fig. 3). The ESI-MS data demonstrate that the Fe³⁺ ions can bind with DNA₆ forming a DNA₆-Fe³⁺ complex. The nanoclusters (DNA₁-AgNC) have a broad absorption band in 400-600 nm with maxima at 424 and 520 nm because of electronic transitions for small silver clusters, especially Ag₂ and Ag₃, are expected in this spectral region ^[13]. However, once adding Fe³⁺ ions into the solution of DNA₁-AgNCs, λ_max shifted from 424 to 395 nm (Fig. 4), and then the emission of DNA₁- AgNCs following direct excitation of electronic bands of silver clusters decreased. These suggest that the Fe³⁺ can bind to sequence (DNA_T) resulting in the effective aggregation of DNA_n- Ag clusters (n = 1, 5c) and the formation of non-emission nanoclusters (DNA_n-AgNC-Fe).

Fig. 3

	Download: JPG larger image
Fig. 3.ESI-MS spectrum of DNA6-Fe3+ system.

Fig. 4

	Download: JPG larger image
Fig. 4.UV-vis absorption spectra of: DNA1 (black line); DNA1-AgNCs (blue line); DNA1-AgNCs in the presence of Fe3+ (green line), Inset: DNA1 (black line); DNA1- AgNCs (blue line); DNA1-AgNCs in the presence of Fe3+ (green line).

New types of fluorescent silver nanoclusters were synthesized utilizing C-rich bifunctional nucleotides as templates. It is found that the GAG containing sequences assemble with DNA_n-AgNCs, synthesized by C3T-rich nucleotides, producing new silver clusters with an enhanced red emission at about 660 nm. Besides, the synthesized silver nanoclusters with GAG containing sequences are sensitive to Fe³⁺ and Fe²⁺ ions due to the formation of nonemission DNA₁-AgNCs-Fe nanoclusters. This will give a new path for the development of metal ion sensors based on the recognition of metal ions with the special sequence in DNA-Ag nanoclusters. Thus, GAG-containing nucleotides can be an enhancer for the emission of silver clusters with C3T-rich nucleotides and a mediator of the iron-clusters interplay.

Financial support of National Natural Science Foundation of China (No. 21271090) and Coordination Chemistry State key Laboratory Foundation of Nanjing University.

Supplementary material related to this article can be found, in the online version, at http://dx.doi.org/10.1016/j.cclet.2015.12.013.